Insert string in alternate lines Post: 302493626

10 More Discussions You Might Find Interesting

1. UNIX for Dummies Questions & Answers

alternate lines from two files

A basic request two files want to combine them but on alternate lines

2. Shell Programming and Scripting

alternate lines

Hi, I'm new to Unix. I want to read the all the lines from a text file and write the alternate lines into another file. Please give me a shell script solution. file1 ----- one two three four five six seven newfile(it should contain the alternate lines from the file1) ------- one...

3. Shell Programming and Scripting

reading alternate lines of a file

hi, i have 2 files. file1: 1 2 3 4 5 6 file2: a b c d e f g h i

4. UNIX for Dummies Questions & Answers

Insert Text on lines having the string word

I need help on how I can accomplish my task. I hope someone can help me since I've researching and trying to accomplish this for hours now. Basically, I need to comment-out (or insert a # sign in the beginning of the line) a line when the line has the specific word I am searching. Example I have...

5. Shell Programming and Scripting

Insert a string instead of blank lines

how can i insert a string sush as "###" instead of blank lines in a file? i try this code but it doesn't work! awk 'NF<1 {$1=="###" ; print$0}' in_file > out_file

6. Programming

Perl : joining alternate lines

Hi, I need to join every alternate line in a file for eg:input file $ cat abc abc def ghi jkloutput abc def ghi jklcode i wrote for this $ cat add_line.pl #!/usr/bin/perl -w my $count=1; #my $line=undef; my @mem_line; my $i=0; my $x=0;

7. Shell Programming and Scripting

Grep values on alternate lines

Hi, I have a file like 2011|ACC|.* 2013|ACC|.* 2011|ACCC|.* 2013|ACCC|.* 2013|ACCV|.* 2011|ADB|.* 2013|ADB|.* 2011|ADBC|.* 2013|ADBC|.* 2011|AIA|.* 2013|AXJ|.* 2013|NNN|.* .* represnts any alphanumeric characters after this part of the string I need a code to return only the...

8. Shell Programming and Scripting

Process alternate lines in awk/sed/perl

hi.. i have a fasta file with the following format >sequence1 CCGGTTTTCGATTTGGTTTGACT >sequence2 AAAGTGCCGCCAGGTTTTGAGTGT >sequence3 AGTGCCGCAGAGTTTGTAGTGT Now, i want to read alternate line and add "GGGGGGGGGGG" to end of every sequence Desired output: >sequence1...

9. Shell Programming and Scripting

Insert String every n lines, resetting line counter at desired string

I need to read a text file and insert a string every n lines, but also have the line counter restart when I come across a header string. Line repeating working every 3 lines using code: sed '0~3 s/$/\nINSERT/g' < INPUT/PATH/FILE_NAME.txt > OUTPUT/PATH/FILE_NAME.txt I cannot seem to find...

10. Shell Programming and Scripting

Comparing alternate lines of code

Hi gents, Have only a passing familiarity with linux/shell at this point, so please forgive simple question. I have text files that have lines something like the following: a b c d d d e f e f e f a b

LEARN ABOUT REDHAT

mkoctfile

MKOCTFILE(1)						      General Commands Manual						      MKOCTFILE(1)

NAME

       mkoctfile - Compile dynamic-load modules for GNU Octave

SYNOPSIS

       mkoctfile [-IDIR] [-DDEF] [-lLIB] [-LDIR] [-M|--depend]	  [-c] [-o   FILE|--output  FILE] [-p  VAR|--print  VAR] [-s|--strip]	[-v|--ver-
       bose] [-h|-?|--help] file ...

DESCRIPTION

       mkoctfile is used to compile source C, C++ or Fortran source code in dynamically loadble file for octave(1).

OPTIONS

       mkoctfile accepts the following options:

       -IDIR   Add include directory DIR to compile commands.

       -DDEF   Add definition DEF to compiler call.

       -lLIB   Add library LIB to link command.

       -LDIR   Add library directory DIR to link command.

       -M|--depend
	       Generate dependency files (.d) for C and C++ source files.

       -c      Compile but do not link.

       -o FILE|--output FILE
	       Output file name; default extension is .oct.

       -p VAR|--print VAR
	       Print configuration variable VAR.  Recognized variables are:
		   CPPFLAGS    CPICFLAG
		   INCFLAGS    CXX
		   F2C	       CXXFLAGS
		   F2CFLAGS    CXXPICFLAG
		   F77	       XTRA_CFLAGS
		   FFLAGS      XTRA_CXXFLAGS
		   FPICFLAG    SHLEXT
		   CC	       SH_LD
		   CFLAGS      SH_LDFLAGS

       -s|--strip
	       Strip the output file.

       -v|--verbose
	       Echo commands as they are executed.

       file    Compile or linke file. Recognised file types are
		   .c	 C source
		   .cc	 C++ source
		   .C	 C++ source
		   .cpp  C++ source
		   .f	 Fortran source
		   .F	 Fortran source
		   .o	 object file
		   .SH SEE ALSO
		   .BR octave (1).

AUTHOR

       John W. Eaton <jwe@bevo.che.wisc.edu>

       This manual page was contributed by Dirk Eddelbuettel <edd@debian.org> for the Debian GNU/Linux distribution but may be used by others.

GNU Octave							  1 November 2002						      MKOCTFILE(1)