Sponsored Content
Top Forums Shell Programming and Scripting [Solved] Need help in editing a script Post 302887331 by Chubler_XL on Thursday 6th of February 2014 09:50:40 PM
Old 02-06-2014
sftp exit status will only reflect if it managed to connect to the server or not and disregards any transfer that fails. Using batch input -b script_file tends to report these errors better.

Try:
Code:
#!/bin/sh
HOST='ftp.xxxx_xxxx.com'
USER='user_1'
FILE='test_bill.txt'
cat > /tmp/script_file_$$ <<EOF
    get $FILE
    exit
EOF

sftp -b /tmp/script_file_$$ $USER@$HOST
exist_status=$?
rm -f /tmp/script_file_$$

if [ $exit_status != 0 ];then
   echo "SFTP file transfer is failed for file $FILE" |mailx indocs_user@scrach.com
else
echo "SFTP file transfer is successfull for file $FILE" |mailx indocs_user@scrach.com
cp $FILE $FILE.`date +%m%d%y`
fi

 

9 More Discussions You Might Find Interesting

1. Shell Programming and Scripting

Editing a file using a script

Hi I have about 10 config files belonging to software that runs on SCO UNIX. These files contain, amongst many other things, a path which points to the software locations. We normally have to change them manually every time the software is coppied to a new location and when you gotta do a few... (45 Replies)
Discussion started by: Ypnos
45 Replies

2. Shell Programming and Scripting

SH Script help. editing string

I have a string that looks like this username|field1|field2|field3 the data has a delimiter of "|" how can i edit field1, keeping the rest of the data the same also how can i edit field2 and 3. (3 Replies)
Discussion started by: nookie
3 Replies

3. UNIX for Dummies Questions & Answers

dos2unix - editing script - Help Urgent Please

Hi this is my first time on this forum so sorry if I posted this to the wrong area. I need help with the following. I have a basic FormMail cgi script I use. When I upload the script using filezilla, there is one line in the script that changes. The line should read &get_date; instead it... (2 Replies)
Discussion started by: lydp101
2 Replies

4. Solaris

editing files with script

hi guys, We have to implement new local (/etc/default/login) USER security policy on almost 50 stations. so editing /etc/default/login and /etc/default/passwd will be way too long work. Can we do the same using some script, I mean editing the above files and putting variables as RETRIES=3, ... (5 Replies)
Discussion started by: Asteroid
5 Replies

5. UNIX for Dummies Questions & Answers

Editing Shell Script

Hi I'm a newbie, but I understand that there's some space difference between unix and the pc, which is why I can't write shell script on my pc but I can view it using notepad, wordpad, etc. Is there any program I can use that will let me view the shell script and edit it without screwing up... (6 Replies)
Discussion started by: qtip
6 Replies

6. UNIX for Dummies Questions & Answers

Making a script for editing

Hello all. I am trying to make a script to edit any file by replacing a string with a string. The script should be able to be applied to any given file. for instance it should be able to replace "foo" with "bar" in the file myFile.txt. I know i need to make a back up file for this to work. I just... (2 Replies)
Discussion started by: iwatk003
2 Replies

7. Shell Programming and Scripting

editing a file in a script

Gurus, I need to write a shell script that will calculate hash value of a file, opens the file in an application for example vi editor. The application can read or modify the contents of the file. When application exists second part of my script will kick in and recalculate the hash value. File... (1 Reply)
Discussion started by: c0kazaz
1 Replies

8. Shell Programming and Scripting

[Solved] Editing the alphabet's based on position information

I do have a file of the following format file 1 >SAM ATGCTCCTTAGCTACGTAGCAAGTAGAAAAAA AGCGCGAGCATTGAAGCGGAGGAGAGGAGGA TGAGATGATGACCCAGTATAAAGAGTGATGAT like this above file. file 1 has 1000's of lines. I would like to edit this file1 using the information from file2 (see below), by... (16 Replies)
Discussion started by: Lucky Ali
16 Replies

9. Shell Programming and Scripting

Convert vi editing to text editing

Dear Guru's I'm using Putty and want to edit a file. I know we generally use vi editor to do it. As I'm not good in using vi editor, I want to convert the vi into something like text pad. Is there any option in Putty to do the same ? Thanks for your response. Srini (6 Replies)
Discussion started by: thummi9090
6 Replies
AUTOEXPECT(1)						      General Commands Manual						     AUTOEXPECT(1)

NAME
autoexpect - generate an Expect script from watching a session SYNOPSIS
autoexpect [ args ] [ program args... ] INTRODUCTION
autoexpect watches you interacting with another program and creates an Expect script that reproduces your interactions. For straightline scripts, autoexpect saves substantial time over writing scripts by hand. Even if you are an Expect expert, you will find it convenient to use autoexpect to automate the more mindless parts of interactions. It is much easier to cut/paste hunks of autoexpect scripts together than to write them from scratch. And if you are a beginner, you may be able to get away with learning nothing more about Expect than how to call autoexpect. The simplest way to use autoexpect is to call it from the command line with no arguments. For example: % autoexpect By default, autoexpect spawns a shell for you. Given a program name and arguments, autoexpect spawns that program. For example: % autoexpect ftp ftp.cme.nist.gov Once your spawned program is running, interact normally. When you have exited the shell (or program that you specified), autoexpect will create a new script for you. By default, autoexpect writes the new script to "script.exp". You can override this with the -f flag fol- lowed by a new script name. The following example runs "ftp ftp.cme.nist.gov" and stores the resulting Expect script in the file "nist". % autoexpect -f nist ftp ftp.cme.nist.gov It is important to understand that autoexpect does not guarantee a working script because it necessarily has to guess about certain things - and occasionally it guesses wrong. However, it is usually very easy to identify and fix these problems. The typical problems are: o Timing. A surprisingly large number of programs (rn, ksh, zsh, telnet, etc.) and devices (e.g., modems) ignore keystrokes that arrive "too quickly" after prompts. If you find your new script hanging up at one spot, try adding a short sleep just before the previous send. You can force this behavior throughout by overriding the variable "force_conservative" near the beginning of the generated script. This "conservative" mode makes autoexpect automatically pause briefly (one tenth of a second) before sending each char- acter. This pacifies every program I know of. This conservative mode is useful if you just want to quickly reassure yourself that the problem is a timing one (or if you really don't care about how fast the script runs). This same mode can be forced before script generation by using the -c flag. Fortunately, these timing spots are rare. For example, telnet ignores characters only after entering its escape sequence. Modems only ignore characters immediately after connecting to them for the first time. A few programs exhibit this behavior all the time but typically have a switch to disable it. For example, rn's -T flag disables this behavior. The following example starts autoexpect in conservative mode. autoexpect -c The -C flag defines a key to toggle conservative mode. The following example starts autoexpect (in non-conservative mode) with ^L as the toggle. (Note that the ^L is entered literally - i.e., enter a real control-L). autoexpect -C ^L The following example starts autoexpect in conservative mode with ^L as the toggle. autoexpect -c -C ^L o Echoing. Many program echo characters. For example, if you type "more" to a shell, what autoexpect actually sees is: you typed 'm', computer typed 'm', you typed 'o', computer typed 'o', you typed 'r', computer typed 'r', ... Without specific knowledge of the program, it is impossible to know if you are waiting to see each character echoed before typ- ing the next. If autoexpect sees characters being echoed, it assumes that it can send them all as a group rather than inter- leaving them the way they originally appeared. This makes the script more pleasant to read. However, it could conceivably be incorrect if you really had to wait to see each character echoed. o Change. Autoexpect records every character from the interaction in the script. This is desirable because it gives you the ability to make judgements about what is important and what can be replaced with a pattern match. On the other hand, if you use commands whose output differs from run to run, the generated scripts are not going to be correct. For example, the "date" command always produces different output. So using the date command while running autoexpect is a sure way to produce a script that will require editing in order for it to work. The -p flag puts autoexpect into "prompt mode". In this mode, autoexpect will only look for the the last line of program output - which is usually the prompt. This handles the date problem (see above) and most others. The following example starts autoexpect in prompt mode. autoexpect -p The -P flag defines a key to toggle prompt mode. The following example starts autoexpect (in non-prompt mode) with ^P as the toggle. Note that the ^P is entered literally - i.e., enter a real control-P. autoexpect -P ^P The following example starts autoexpect in prompt mode with ^P as the toggle. autoexpect -p -P ^P OTHER FLAGS
The -quiet flag disables informational messages produced by autoexpect. The -Q flag names a quote character which can be used to enter characters that autoexpect would otherwise consume because they are used as toggles. The following example shows a number of flags with quote used to provide a way of entering the toggles literally. autoexpect -P ^P -C ^L -Q ^Q STYLE
I don't know if there is a "style" for Expect programs but autoexpect should definitely not be held up as any model of style. For example, autoexpect uses features of Expect that are intended specifically for computer-generated scripting. So don't try to faithfully write scripts that appear as if they were generated by autoexpect. This is not useful. On the other hand, autoexpect scripts do show some worthwhile things. For example, you can see how any string must be quoted in order to use it in a Tcl script simply by running the strings through autoexpect. SEE ALSO
"Exploring Expect: A Tcl-Based Toolkit for Automating Interactive Programs" by Don Libes, O'Reilly and Associates, January 1995. AUTHOR
Don Libes, National Institute of Standards and Technology expect and autoexpect are in the public domain. NIST and I would appreciate credit if these programs or parts of them are used. 30 June 1995 AUTOEXPECT(1)
All times are GMT -4. The time now is 03:22 PM.
Unix & Linux Forums Content Copyright 1993-2022. All Rights Reserved.
Privacy Policy