Sponsored Content
Top Forums Shell Programming and Scripting Need to cut a specific pattern from a line Post 302976981 by Don Cragun on Sunday 10th of July 2016 05:00:33 AM
Old 07-10-2016
Quote:
Originally Posted by mirwasim
I got below error.
I want to print the third field and the the url .
url is not at specific position every time, it can be at filed 10, 12 13 and so on.
i want script to pick where ever it is in the line
Code:
awk: syntax error near line 1
awk: bailing out near line 1

Moderator's Comments:
Mod Comment Pleae use CODE tags (not ICODE tags) when displaying full-line and multi-line sample input, sample output, and code segments.
When using awk on Solaris/SunOS systems, change awk to /usr/xpg4/bin/awk or nawk.
 

10 More Discussions You Might Find Interesting

1. Shell Programming and Scripting

merge columns into one line after a specific pattern

Hi all, im a linux newbie, plz help! I have a file - box -------- Fox-2 -------- UF29 zip42 -------- zf-CW SNF2_N Heli_Z -------- Fox -------- Kel_1 box (3 Replies)
Discussion started by: sam_2921
3 Replies

2. Shell Programming and Scripting

To cut a specific line

Hi, I need to remove a specific line from a file.. For eg: From the html codings, I need to find the word "iframe frameborder" and cut it . I tried with find . -type f -exec grep -H 'iframe frameborder' {} \; > <filename> From the output of this result, I need to remove the "iframe... (14 Replies)
Discussion started by: gsiva
14 Replies

3. Shell Programming and Scripting

How to cut first line only from a text near a specific column without cutting a word

First I have to say thank you to this community and this forum. You helped me very much builing several useful scripts. Now, I can't get a solution the following problem, I'm stuck somehow. Maybe someone has an idea. In short, I dump a site via lynx and pipe the output in a file. I need to... (7 Replies)
Discussion started by: lowmaster
7 Replies

4. Shell Programming and Scripting

How to cut specific line and one line under?

Hi guys, I need to analyze the following alert log file: Beginning log switch checkpoint up to RBA , SCN: 3916025539605 Sat May 1 00:54:52 2010 Thread 1 advanced to log sequence 271423 (LGWR switch) Current log# 1 seq# 271423 mem# 0: /dw/stg_redo01/log_dwstg_g1_m1.log Current log# 1... (7 Replies)
Discussion started by: nir_s
7 Replies

5. Shell Programming and Scripting

cut specific pattern

Hi i want to cut a variable like if it is ABCDEF then i want to cut "DEF" only Please help me regarding this. (1 Reply)
Discussion started by: aishsimplesweet
1 Replies

6. Programming

Print specific pattern line in c++

Input file: @HWI-BRUNOP1_header_1 GACCAATAAGTGATGATTGAATCGCGAGTGCTCGGCAGATTGCGATAAAC +HWI-BRUNOP1_header_1 TNTTJTTTETceJSP__VRJea`_NfcefbWe Desired output file: >HWI-BRUNOP1_header_1 GACCAATAAGTGATGATTGAATCGCGAGTGCTCGGCAGATTGCGATAAAC >HWI-BRUNOP1_header_2... (10 Replies)
Discussion started by: cpp_beginner
10 Replies

7. Shell Programming and Scripting

sed or awk, cut, to extract specific data from line

Hi guys, I have been trying to do this, but... no luck so maybe you can help me. I have a line like this: Total Handled, Received, on queue Input Mgs: 140 / 14 => 0 I need to, get the number after the / until the =, to get only 14 . Any help is greatly appreciated. Thanks, (4 Replies)
Discussion started by: ocramas
4 Replies

8. Shell Programming and Scripting

Replace string in line below specific pattern?

Hi, I'm trying to replace a string with sed, in a text file containing this pattern: location alpha value x location beta value y location gamma value y location delta value y location theta value z ... What I want to achieve is: Find location beta into text file... (1 Reply)
Discussion started by: TECK
1 Replies

9. Shell Programming and Scripting

Replace the line with specific pattern

Hello All I'm trying to change one string from a file contening this patern: xxxx-xxxx 4 numbers - end 4 other numbers This is a sample of the file: LDR 00679 am a2200205 4500 =001 3617 =008 030219s2000\\\\xxx|||||\||||\00|\0\spa\d =020 \\$a0211-1942 =041 \\$aCastellà =093 ... (5 Replies)
Discussion started by: ldiaz2106
5 Replies

10. Shell Programming and Scripting

Extract specific line in an html file starting and ending with specific pattern to a text file

Hi This is my first post and I'm just a beginner. So please be nice to me. I have a couple of html files where a pattern beginning with "http://www.site.com" and ending with "/resource.dat" is present on every 241st line. How do I extract this to a new text file? I have tried sed -n 241,241p... (13 Replies)
Discussion started by: dejavo
13 Replies
ucblinks(1B)					     SunOS/BSD Compatibility Package Commands					      ucblinks(1B)

NAME
       ucblinks - adds /dev entries to give SunOS 4.x compatible names to SunOS 5.x devices

SYNOPSIS
       /usr/ucb/ucblinks [-e rulebase] [-r rootdir]

DESCRIPTION
       ucblinks  creates symbolic links under the /dev directory for devices whose SunOS 5.x names differ from their SunOS 4.x names. Where possi-
       ble, these symbolic links point to the device's SunOS 5.x name rather than to the actual /devices entry.

       ucblinks does not remove unneeded compatibility links; these must be removed by hand.

       ucblinks should be called each time the system is reconfiguration-booted, after any new SunOS 5.x links that are needed have been  created,
       since the reconfiguration may have resulted in more compatibility names being needed.

       In  releases prior to SunOS 5.4, ucblinks used a  nawk rule-base to construct the SunOS 4.x compatible names. ucblinks no longer uses  nawk
       for the default operation, although  nawk rule-bases can still be specifed with the -e option.  The  nawk rule-base equivalent to the SunOS
       5.4 default operation can be found in /usr/ucblib/ucblinks.awk.

OPTIONS
       -e rulebase     Specify rulebase as the file containing nawk(1) pattern-action statements.

       -r rootdir      Specify rootdir as the directory under which dev and devices will be found, rather than the standard root directory /.

FILES
       /usr/ucblib/ucblinks.awk        sample rule-base for compatibility links

ATTRIBUTES
       See attributes(5) for descriptions of the following attributes:

       +-----------------------------+-----------------------------+
       |      ATTRIBUTE TYPE	     |	    ATTRIBUTE VALUE	   |
       +-----------------------------+-----------------------------+
       |Availability		     |SUNWscpu			   |
       +-----------------------------+-----------------------------+

SEE ALSO
       devlinks(1M), disks(1M), ports(1M), tapes(1M), attributes(5)

SunOS 5.10							    13 Apr 1994 						      ucblinks(1B)
All times are GMT -4. The time now is 03:38 PM.
Unix & Linux Forums Content Copyright 1993-2022. All Rights Reserved.
Privacy Policy