Hello All,
May i please know how do i ensure my split command would NOT generate incomplete output files like below, the last lines in each file is missing some columns or last line is complete.
Hi,
I have a problem in grepping a file for 2 strings and writing them to 2 appropriate files. I need to use the awk command and read the file only once and write to the appropriate file.
My file is very huge in size and it is taking a long time using cat command and grep command.
Can anyone... (3 Replies)
Hi folks,
I am using the join command to join two files on a common field as follows:
File1.txt
Adsorption|H01.181.529.047
Adult|M01.060.116
Children|M01.055
File2.txt
5|Adsorption|C0001674
7|Adult|C000001
6|Children|C00002
join -i -t "|" -a 2 -1 1 -2 2 File1.txt File2.txt
This... (7 Replies)
On Solaris & AIX, suppose there is a directory 'dir'.
Log files of size approx 1MB are continuously being
deposited here by scp command. I have a script that scans
this dir every 5 mins and moves away the log files that
have been deposited so far.
How do I design my script so that I pick up... (6 Replies)
On Solaris, suppose there is a directory 'dir'.
Log files of size approx 1MB are continuously being
deposited here by scp command. I have a script that scans
this dir every 5 mins and moves away the log files that
have been deposited so far.
How do I design my script so that I pick up *only*... (6 Replies)
Hi everyone,
I have some large text files that I need to split into a specific number of files of equal size. As far as I know (and I don't really know that much :)) the split command only lets you specify the number of lines or bytes. The files are all of a different size, so the number of... (4 Replies)
need to check hardware error are zero
iostat -en |awk '{ if ( $2 == 0 ) { print " " } else { print " Hardware errors "} }
can someone please tell me whats wrong with this
---------- Post updated at 10:19 PM ---------- Previous update was at 10:16 PM ----------
iostat -en
----... (11 Replies)
Hello,
I would like to split a file but I dont what the subfiles to be named the way they are:
ex:
default name: xaa xab xac xad xae
desired name: b01 b02 b03 b04 b05
I know I can rename them afterwards however I have a varialbe split lenghth, in other words I am not sure how... (2 Replies)
Hello,
I've searched this forum and others for a solution to my problem but nothing seems just right, I'm hoping I can get some help (seems like this should be easy, and I apologize if I've missed something on the forum):
I have several large .fastq DNA sequence files (~20million reads,... (2 Replies)
The following code will split the infile into multiple files. However, I need it to insert the same first 3 lines from the original input file into each splitted file. How do I modify my script below to do so:
print -n "Enter file name to split? " ; read infile
if
then
echo "Invalid file... (4 Replies)
I have two files containing hundreds of different sequences with the same Identifiers (ID-001, ID-002, etc.,), something like this:
Infile1:
ID-001 ATGGGAGCGGGGGCGTCTGCCTTGAGGGGAGAGAAGCTAGATACA
ID-002 ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACA
ID-003... (18 Replies)
Discussion started by: Xterra
18 Replies
LEARN ABOUT OSF1
split
split(1) General Commands Manual split(1)NAME
split - Splits a file into pieces
SYNOPSIS
Current syntax
split [-l line_count] [-a suffix_length] [file | -] [prefix]
split -b n [k|m] [-a suffix_length] [file | -] [prefix]
Obsolescent syntax
split [-number] [-a suffix_length] [file | -] [prefix]
STANDARDS
Interfaces documented on this reference page conform to industry standards as follows:
split: XCU5.0
Refer to the standards(5) reference page for more information about industry standards and associated tags.
OPTIONS
Uses suffix_length letters to form the suffix portion of the file names of the split file. If -a is not specified, the default suffix
length is two letters. If the sum of the prefix and the suffix arguments would create a file name exceeding NAME_MAX bytes, an error
occurs. In this case, split exits with a diagnostic message and no files are created. Split a file into pieces n bytes in size. Split a
file into pieces n kilobytes (1024 bytes) in size. Split a file into pieces n megabytes (1048576 bytes) in size. Specifies the number of
lines in each output file. The line_count argument is an unsigned decimal integer. The default value is 1000. If the input does not end
with a newline character, the partial line is included in the last output file. Specifies the number of lines in each output file. The
default is 1000 lines per output file. If the input does not end with a newline character, the partial line is included in the last output
file. (Obsolescent)
OPERANDS
The pathname of the file to be split.
If you do not specify an input file, or if you specify -, the standard input is used.
DESCRIPTION
The split command reads file and writes it in number-line pieces (default 1000 lines) to a set of output files.
The size of the output files can be modified by using the -b or -l options. Each output file is created with a unique suffix consisting of
exactly suffix lowercase letters from the POSIX locale. The letters of the suffix are used as if they were a base-26 digit system, with
the first suffix to be created consisting of all a characters, the second with b replacing the last a etc., until a name of all zs is cre-
ated. By default, the names of the output files are x, followed by a two-character suffix from the character set as described above,
starting with aa, ab, ac, etc., and continuing until the suffix zz, for a maximum of 676 files.
The value of prefix cannot be longer than the value of NAME_MAX from <limits.h> minus two.
If the number of files required is greater than the maximum allowed by the effective suffix length (such that the last allowable file would
be larger than the requested size), split fails after creating the last possible file with a valid suffix. The split command will not
delete the files it created with valid suffixes. If the file limit is not exceeded, the last file created contains the remainder of the
input file and thus might be smaller than the requested size.
EXIT STATUS
The following exit values are returned: Successful completion. An error occurred.
EXAMPLES
To split a file into 1000-line segments, enter: split book
This splits book into 1000-line segments named xaa, xab, xac, and so forth. To split a file into 50-line segments and specify the
file name prefix, enter: split -l50 book sect
This splits book into 50-line segments named sectaa, sectab, sectac, and so forth.
ENVIRONMENT VARIABLES
The following environment variables affect the execution of split: Provides a default value for the internationalization variables that are
unset or null. If LANG is unset or null, the corresponding value from the default locale is used. If any of the internationalization vari-
ables contain an invalid setting, the utility behaves as if none of the variables had been defined. If set to a non-empty string value,
overrides the values of all the other internationalization variables. Determines the locale for the interpretation of sequences of bytes
of text data as characters (for example, single-byte as opposed to multibyte characters in arguments and input files). Determines the
locale for the format and contents of diagnostic messages written to standard error. Determines the location of message catalogues for the
processing of LC_MESSAGES.
SEE ALSO
Commands: bfs(1), csplit(1)
Standards: standards(5)split(1)