Linux and UNIX Man Pages

Linux & Unix Commands - Search Man Pages

strncmp(9) [centos man page]

STRNCMP(9)						     Basic C Library Functions							STRNCMP(9)

NAME
strncmp - Compare two length-limited strings SYNOPSIS
int strncmp(const char * cs, const char * ct, size_t count); ARGUMENTS
cs One string ct Another string count The maximum number of bytes to compare COPYRIGHT
Kernel Hackers Manual 3.10 June 2014 STRNCMP(9)

Check Out this Related Man Page

STRNCMP(3P)						     POSIX Programmer's Manual						       STRNCMP(3P)

PROLOG
This manual page is part of the POSIX Programmer's Manual. The Linux implementation of this interface may differ (consult the correspond- ing Linux manual page for details of Linux behavior), or the interface may not be implemented on Linux. NAME
strncmp - compare part of two strings SYNOPSIS
#include <string.h> int strncmp(const char *s1, const char *s2, size_t n); DESCRIPTION
The strncmp() function shall compare not more than n bytes (bytes that follow a null byte are not compared) from the array pointed to by s1 to the array pointed to by s2. The sign of a non-zero return value is determined by the sign of the difference between the values of the first pair of bytes (both inter- preted as type unsigned char) that differ in the strings being compared. RETURN VALUE
Upon successful completion, strncmp() shall return an integer greater than, equal to, or less than 0, if the possibly null-terminated array pointed to by s1 is greater than, equal to, or less than the possibly null-terminated array pointed to by s2 respectively. ERRORS
No errors are defined. The following sections are informative. EXAMPLES
None. APPLICATION USAGE
None. RATIONALE
None. FUTURE DIRECTIONS
None. SEE ALSO
strcmp(), the Base Definitions volume of IEEE Std 1003.1-2001, <string.h> COPYRIGHT
Portions of this text are reprinted and reproduced in electronic form from IEEE Std 1003.1, 2003 Edition, Standard for Information Technol- ogy -- Portable Operating System Interface (POSIX), The Open Group Base Specifications Issue 6, Copyright (C) 2001-2003 by the Institute of Electrical and Electronics Engineers, Inc and The Open Group. In the event of any discrepancy between this version and the original IEEE and The Open Group Standard, the original IEEE and The Open Group Standard is the referee document. The original Standard can be obtained online at http://www.opengroup.org/unix/online.html . IEEE
/The Open Group 2003 STRNCMP(3P)
Man Page

10 More Discussions You Might Find Interesting

1. UNIX for Dummies Questions & Answers

Carreer:Networking Programming in Unix (C programming Language)

Hello, I am trying to learn Networking Programming in C in unix enviorment. I want to know how good it is to become a network programmer. i am crazy about Network programming but i also want to opt for the best carreer options. Anybody experienced Network Programmer, please tell me is my... (5 Replies)
Discussion started by: vibhory2j
5 Replies

2. Programming

Print specific pattern line in c++

Input file: @HWI-BRUNOP1_header_1 GACCAATAAGTGATGATTGAATCGCGAGTGCTCGGCAGATTGCGATAAAC +HWI-BRUNOP1_header_1 TNTTJTTTETceJSP__VRJea`_NfcefbWe Desired output file: >HWI-BRUNOP1_header_1 GACCAATAAGTGATGATTGAATCGCGAGTGCTCGGCAGATTGCGATAAAC >HWI-BRUNOP1_header_2... (10 Replies)
Discussion started by: cpp_beginner
10 Replies

3. Programming

search a file between two begin and end strings in c

Can any one help me out with following problem... I want to search in a file which has two strings repeat each time(like start and end) i want to search between these two string in C programming. please help me with the solution. thanks in advance. (8 Replies)
Discussion started by: uday.sena.m
8 Replies

4. Programming

warning: comparison between pointer and integer

Hi guys :D I am still playing with my C handbook and yes, as you can see I have small problem as always :cool: I wrote a C code #include <stdio.h> #define MESSAGE 100 int main(void) { char input_mes - Pastebin.com And when I try to compile it I get following errors from gcc ... (1 Reply)
Discussion started by: solaris_user
1 Replies

5. Programming

search file and put into struct

hi everybody, I need some help with some programming. I need to write a file that can search in a text file and read the whole line into a struct. the struct = struct Transistor { char chType; char chFabrikant; float fPrijs; enum Transistor_Behuizing { empty,TO18, TO39,... (8 Replies)
Discussion started by: metal005
8 Replies

6. Programming

Changing the way arguments are read from program

I have the following piece of code. Currently the command line arguments are passed as shown below using the "= "sign. I capture the name of the argument, for example vmod and it's corresponding user parameter which is jcdint-z30.cmd. ./raytrac vmod=jcdint-z30.cmd srFile=jcdint.sr Now I want... (12 Replies)
Discussion started by: kristinu
12 Replies

7. Programming

Merge two strings by overlapped region

Hello, I am trying to concatenate two strings by merging the overlapped region. E.g. Seq1=ACGTGCCC Seq2=CCCCCGTGTGTGT Seq_merged=ACGTGCCCCCGTGTGTGTFunction strcat(char *dest, char *src) appends the src string to the dest string, ignoring the overlapped parts (prefix of src and suffix of dest).... (30 Replies)
Discussion started by: yifangt
30 Replies

8. Programming

Need help with counting within parallelized block - OpenMP/C-Programming

Hello together, I have a question for you. Since a few weeks I am trying to programm a small bruteforce application in C on Ubuntu 14.04.1 using Code::Blocks with gcc-4.8.2. My programm is nothing special. It's just for practise, Without hashing or something like that. For me the focus is on... (11 Replies)
Discussion started by: DaveX
11 Replies

9. Programming

Number to bit vector

Is there a function to convert number (unsigned int for this example) to binary? I could not find a simple one thru google. While I was learning bloom filter with the example, I was wondering if anybody can help me to 1) display the real bits vector for the bloomfilter; 2) if dataset is very... (11 Replies)
Discussion started by: yifangt
11 Replies

10. Homework & Coursework Questions

C shell program

1. I've have to write a shell program that accepts Ctrl+T (in linux os in c language) and should print out the current time and date to the screen. I've written the following code but i've to type ^T individual rather than pressing ctrl+T(^T) to get the output. : 2. How do i make the shell... (2 Replies)
Discussion started by: zorro_phu
2 Replies