Linux and UNIX Man Pages

Linux & Unix Commands - Search Man Pages

nautilus-scripts-manager(1) [debian man page]

NAUTILUS-SCRIPTS-MANAGER(1)				      General Commands Manual				       NAUTILUS-SCRIPTS-MANAGER(1)

NAME
nautilus-scripts-manager - easy tool for nautilus scripts management SYNOPSIS
nautilus-scripts-manager [options] DESCRIPTION
This manual page documents briefly the nautilus-scripts-manager command. nautilus-scripts-manager is a program that allows any user to easily manage installed Nautilus scripts. GENERAL OPTIONS
-h, --help Show summary of options. -v, --version Show version of program. COMMANDS
One (and only one) of the following commands can be passed: -e, --enable=ENABLE Enable script ENABLE. -d, --disable=DISABLE Disable script DISABLE. -l, --list-enabled List enabled scripts. -a, --list-available List available scripts. If no command is provided, the graphical interface is started. OPTIONS
-e, --position=POSITION In conjunction with -e or -d: establish the position of the script (can be just a name, or a path with slashes - quote it if it con- tains spaces). SEE ALSO
nautilus(1), AUTHOR
nautilus-scripts-manager and this manual page were written by Pietro Battiston <me@pietrobattiston.it>. This manual page was written for the Debian project (but may be used by others). July 14, 2009 NAUTILUS-SCRIPTS-MANAGER(1)

Check Out this Related Man Page

nautilus-actions-run(1) 				      General Commands Manual					   nautilus-actions-run(1)

NAME
nautilus-actions-run - execute an action on the specified target SYNOPSIS
nautilus-actions-run [OPTION] DESCRIPTION
nautilus-actions-run runs specific nautilus-actions on a given file or folder. More than one target may be specified. This program is intended to be used on the command-line for scripting nautilus actions. OPTIONS
Help options -?, --help Show help options --help-all Show all help options --help-misc Show miscellaneous options Miscellaneous options -v, --version Output the version number Application options -i, --id=STRING The internal identifier of the action to be launched. -t, --target=URI A file or folder to run the action on (more than one may be specified). BUGS
Please report bugs in nautilus-actions to <submit@bugs.debian.org>. The current bug list may be viewed at <http://bugs.debian.org/nautilus- actions>. AUTHOR
nautilus-actions was written by Rodrigo Moya <rodrigo@novell.com>, Frederic Ruaudel <grumz@grumz.net>, Pierre Wieser <pwieser@trych- los.org>, and contributors. This manual page was written by Christine Spang <christine@debian.org>, for the Debian project (but may be used by others). LICENSING
Both the nautilus-actions source code and this man page are licensed under the GNU General Public License. SEE ALSO
nautilus(1),nautilus-actions(1),nautilus-actions-schemas(1), nautilus-actions-new(1), nautilus-actions-print(1) Debian GNU/Linux 2009-12-30 nautilus-actions-run(1)
Man Page

15 More Discussions You Might Find Interesting

1. Shell Programming and Scripting

List Duplicate

Hi All This is not class assignment . I would like to know awk script how to list all the duplicate name from a file ,have a look below Sl No Name Dt of birth Location 1 aaa 1/01/1975 delhi 2 bbb 2/03/1977 mumbai 3 aaa 1/01/1976 mumbai 4 ... (22 Replies)
Discussion started by: vakharia Mahesh
22 Replies

2. Shell Programming and Scripting

Simple BASH script?

Hi guys, I'm new to the forum so forgive me if I'm sounding ... daft. I currently work in a Tech Support role. Every day we have to generate data by running around 10 .sh scripts. I was thinking instead of having to ./filename 10 times is it possible to right a new script that will run these for... (16 Replies)
Discussion started by: JayC89
16 Replies

3. Shell Programming and Scripting

Script to test for scripts running

Hi, Im writing a script that will check which scripts are running. The script will run on a 5min loop and the status of the scripts will be written to the log. If any of the scripts arent running an email will be sent out. At the min if all scripts are running an entry is made to the log... (19 Replies)
Discussion started by: runnerpaul
19 Replies

4. Shell Programming and Scripting

Approach to writting a script

Hello all, I've just joined. I did a google search and your site came up, I had a look and thought I'd like to become a member. I'm from Ireland. I've written a few scripts before, but this new task has me foxed. I would like to figure out the best approach to achieving the following ... (15 Replies)
Discussion started by: Bloke
15 Replies

5. Shell Programming and Scripting

Help with this easy problem

hi people. i need assist in this quite easy problem. i have a text as: cell112-1/2/3/4/5/6 4 cell156-1/2/3/4 7 cell197-1/2/3 6 cell215-1/2/3/4/5/6 9 cell235-1/2/3 5 cell354-1/2/3/4/5 8 cell355-1 4 ... cell446-1/2/3/4/5/6 5 the script should check second coloumn in each line and ... (21 Replies)
Discussion started by: gc_sw
21 Replies

6. Shell Programming and Scripting

if else and function.

Hi, I ahve many if else functions in my script but no function is avaialbe. Now I want to write a function and function body should have case statements. But the choice for that case statements should come as a parameter from the each ELSE part of my if-else statements. for eg:... (15 Replies)
Discussion started by: amit.mathur08
15 Replies

7. Shell Programming and Scripting

Help with if-else construct

Hi all i have been trying to do a small 'question and answer' script using if-else statement and a combination of pipe. I have succeeded in allowing the user to login with user name and password stored in a sequence username/password in a file named "pass" like this: echo "please enter your... (14 Replies)
Discussion started by: arikutex
14 Replies

8. Shell Programming and Scripting

Terminate initially if error found...

Hi, I have written a shell script which is a combination of 5 scripts into one. We have a Record Claim indicator in the scpt ($rc) with which we can come to an conclusion if the script failed to load the data or if the data loaded successfully. Can any one please help me as to how to... (16 Replies)
Discussion started by: msrahman
16 Replies

9. Shell Programming and Scripting

Running jobs in parallel

I need to process 50 sqlplus scripts which are listed in a text file. I need to develop a shell script that'll read this file and run these sqlplus scripts. At any point of time, the number of sqlplus scripts running shouldn't exceed 6. If any of the sqlplus scripts completes successfully then... (17 Replies)
Discussion started by: gctex
17 Replies

10. Shell Programming and Scripting

ps command in scripts

I want to write 2 scripts that: script named "users" - List of users logged into the system; script named "ps" - List of all processes in the operating system; # is it true? #!bin/bash echo 'content-type: text/html' echo users # for script named users #!bin/bash echo 'content-type:... (15 Replies)
Discussion started by: numeracy
15 Replies

11. Shell Programming and Scripting

Can't submit a form.

hello my script is submitting POST-data to a site (its not my first script, i've done these before many times (include parsing scripts) but this one is tough) so the problem is i'm submitting a form with firefox and in firebug i see WHAT exactly i'm submitting then when i do EXACTLY the... (28 Replies)
Discussion started by: tip78
28 Replies

12. Shell Programming and Scripting

Fork: Resource temporarily unavailable

Hi friends, Working on a linux X86-64 bit system, I suddenly started getting this error (mentioned in subject) from various scripts. I googled, found that there are couple of reason which causes this issue. - less memory I am pretty sure, memory seems to be stable on my system and at the... (15 Replies)
Discussion started by: clx
15 Replies

13. Shell Programming and Scripting

[Solved] Editing the alphabet's based on position information

I do have a file of the following format file 1 >SAM ATGCTCCTTAGCTACGTAGCAAGTAGAAAAAA AGCGCGAGCATTGAAGCGGAGGAGAGGAGGA TGAGATGATGACCCAGTATAAAGAGTGATGAT like this above file. file 1 has 1000's of lines. I would like to edit this file1 using the information from file2 (see below), by... (16 Replies)
Discussion started by: Lucky Ali
16 Replies

14. Shell Programming and Scripting

Wget - how to ignore files in immediate directory?

i am trying to recursively save a remote FTP server but exclude the files immediately under a directory directory1 wget -r -N ftp://user:pass@hostname/directory1 I want to keep these which may have more files under them directory1/dir1/file.jpg directory1/dir2/file.jpg... (16 Replies)
Discussion started by: vanessafan99
16 Replies

15. Ubuntu

Using color in scripts

This is supposed to colorize. But it outputs this 3 GREEN='3; then echo -e "${GREEN}File exists.${RESET}" else echo -e "${RED}File does NOT exist.${RESET}" fi (18 Replies)
Discussion started by: drew77
18 Replies