Login or Register to Ask a Question and Join Our Community

Linux and UNIX Man Pages

Linux & Unix Commands - Search Man Pages

tqs(1) [debian man page]

TQS(1)							      General Commands Manual							    TQS(1)

NAME

       tqs - Trim Quality Solexa-Illumina Sequences

SYNOPSIS

       Quality trim solexa-Illumina sequence reads using user-defined thresholds.

OPTIONS

       -h, --help
		 show this help message and exit

       -f SEQFILE, --sequence file=SEQFILE
		 Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
		     7	     1	     255     669
		     AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

       -q QUALFILE, --qual file=QUALFILE
		 A prb file containing all the Illumina intensities, as outputted by the 1G Genome Analyzer (_prb.txt)

       -l MER, --length=MER
		 Length of sequence reads (i.e. Number of sequencing cycles, default=36)

       -t THRESHOLD, --threshold=THRESHOLD
		 Base intensity threshold value (-40 to 40, default=5)

       -d DIFF, --difference=DIFF
		 Base intensity difference between top intensity and second best (1 to 80, default=5)

       -c CONSEC, --consec=CONSEC
		 Minimum number of consecutive bases passing threshold values (default=20)

       -v, --verbose
		 Runs in Verbose mode.

SEE ALSO

       /usr/share/doc/ssake/TQS.readme

AUTHORS

       This  manual page was written by Andreas Tille <tille@debian.org> for the Debian system (but may be used by others).  Permission is granted
       to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any later version published by
       the Free Software Foundation.

       On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.

								   January 2008 							    TQS(1)

Check Out this Related Man Page

py_xls2txt(1)						      General Commands Manual						     py_xls2txt(1)

NAME

       py_xls2txt - convert an Excel xls file to a plain text file

SYNOPSIS

       py_xls2txt  input-file

DESCRIPTION

       This manual page was written for the Debian distribution because the original program does not have a manual page.

       py_xls2txt takes an Excel xls file as an argument and converts it to a plain text file.	Output is sent to stdout.

       Additional utility scripts can be found in the tools/ directory.

OPTIONS

       This program does not take any command line options.

AUTHOR

       pyexcelerator and py_xls2txt were written by Roman V. Kiseliov <roman@kiseliov.ru>.

       This manual page was written by Kevin Coyner <kcoyner@debian.org> for the Debian system (but may be used by others).  Permission is granted
       to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any  later	version  published
       by the Free Software Foundation.

       On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.

SEE-ALSO
       pyexcelerator(1), py_xls2csv(1), py_xls2html(1)

								 October 12, 2006						     py_xls2txt(1)
Man Page