BP_FLANKS(1p) User Contributed Perl Documentation BP_FLANKS(1p)NAME
flanks - finding flanking sequences for a variant in a sequence position
SYNOPSIS
flanks --position POS [-p POS ...] [--flanklen INT]
accession | filename
DESCRIPTION
This script allows you to extract a subsequence around a region of interest from an existing sequence. The output if fasta formatted
sequence entry where the header line contains additional information about the location.
OPTIONS
The script takes one unnamed argument which be either a file name in the local file system or a nucleotide sequence accession number.
-p Position uses simple nucleotide sequence feature table
--position notation to define the region of interest, typically a
SNP or microsatellite repeat around which the flanks are
defined.
There can be more than one position option or you can
give a comma separated list to one position option.
The format of a position is:
[id:] int | range | in-between [-]
The optional id is the name you want to call the new
sequence. If it not given in joins running number to the
entry name with an underscore.
The position is either a point (e.g. 234), a range (e.g
250..300) or insertion point between nucleotides
(e.g. 234^235)
If the position is not completely within the source
sequence the output sequence will be truncated and it
will print a warning.
The optional hyphen [-] at the end of the position
indicates that that you want the retrieved sequence to be
in the opposite strand.
-f Defaults to 100. This is the length of the nucleotides
--flanklen sequence retrieved on both sides of the given position.
If the source file does not contain
OUTPUT FORMAT
The output is a fasta formatted entry where the description file contains tag=value pairs for information about where in the original
sequence the subsequence was taken.
The ID of the fasta entry is the name given at the command line joined by hyphen to the filename or accesion of the source sequence. If no
id is given a series of consequtive integers is used.
The tag=value pairs are:
oripos=int
position in the source file
strand=1|-1
strand of the sequence compared to the source sequence
allelepos=int
position of the region of interest in the current entry. The tag is the same as used by dbSNP@NCBI
The sequence highlights the allele variant position by showing it in upper case and rest of the sequence in lower case characters.
EXAMPLE
% flanks ~/seq/ar.embl
>1_/HOME/HEIKKI/SEQ/AR.EMBL oripos=100 strand=1 allelepos=100
taataactcagttcttatttgcacctacttcagtggacactgaatttggaaggtggagga
ttttgtttttttcttttaagatctgggcatcttttgaatCtacccttcaagtattaagag
acagactgtgagcctagcagggcagatcttgtccaccgtgtgtcttcttctgcacgagac
tttgaggctgtcagagcgct
TODO
The input files are assumed to be in EMBL format and the sequences are retrieved only from the EMB database. Make this more generic and use
the registry.
head1 FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the
Bioperl mailing lists Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the
web:
https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Heikki Lehvaslaiho
Email: <heikki-at-bioperl-dot-org>
perl v5.14.2 2012-03-02 BP_FLANKS(1p)
Check Out this Related Man Page
Bio::LiveSeq::Mutation(3pm) User Contributed Perl Documentation Bio::LiveSeq::Mutation(3pm)NAME
Bio::LiveSeq::Mutation - Mutation event descriptor class
SYNOPSIS
# full descrition of a point mutation
$mutation1a = Bio::LiveSeq::Mutation->new ( -seq => 'A',
-seqori => 'T',
-pos => 100,
-len => 1 # optional, defaults to length(seq)
);
# minimal information for a point mutation
$mutation1b = Bio::LiveSeq::Mutation->new ( -seq => 'A',
-pos => 100
);
# insertion
$mutation2 = Bio::LiveSeq::Mutation->new ( -seq => 'ATT',
-pos => 100,
-len => 0
);
# deletion
$mutation3 = Bio::LiveSeq::Mutation->new ( -seq => '', # optional
-seqori => 'TTG', # optional
-pos => 100
-len => 3
);
# complex
$mutation4 = Bio::LiveSeq::Mutation->new ( -seq => 'CC',
-seqori => 'TTG', # optional
-pos => 100
-len => 3
);
DESCRIPTION
This class describes a local mutation event using minimalistic description. It is not necessary to know anything about the original
sequence. You need to give the changed sequence, the position of the mutation in the (unidentified) reference sequence, and the length of
the affected subsequence in the reference sequence. If the original allele sequence is given, the objects applying the mutation into the
reference sequence (e.g. Bio::LiveSeq::Mutator) might check for its validity.
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the
Bioperl mailing lists Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address
it. Please include a thorough description of the problem with code and data examples if at all possible.
Reporting Bugs
report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the
web:
https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Heikki Lehvaslaiho
Email: heikki-at-bioperl-dot-org
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
seq
Title : seq
Usage : $obj->seq();
Function:
Sets and returns the mutated sequence. No checking is done
to validate the symbols.
Example :
Returns : string
Args : integer
seqori
Title : seqori
Usage : $obj->seqori();
Function:
Sets and returns the original subsequence in the reference
sequence. No checking is done to validate the symbols.
Optional value.
Example :
Returns : string
Args : string
pos
Title : pos
Usage : $obj->pos();
Function:
Sets and returns the position of the first element in the
sequence.
Example :
Returns : string
Args : integer
len
Title : len
Usage : $obj->len();
Function:
Sets and returns the len of the affected original allele
sequence. If value is not set, defaults to the length of
the mutated sequence (seq).
Example :
Returns : string
Args : string
label
Title : label
Usage : $obj->label();
Function:
Sets and returns the label of the affected original allele
location. Label is a stable identifier whereas location
can be changed by mutations. Label comes from
l<Bio::LiveSeq::Gene>.
Example :
Returns : string
Args : string
transpos
Title : transpos
Usage : $obj->transpos();
Function:
Sets and returns the transcript position of the mutation.
Set when associated with a reference sequence. Value
depends on reference molecule and the co-ordinate system
used.
Example :
Returns : string
Args : integer
issue
Title : issue
Usage : $obj->issue();
Function:
Sets and returns the position of the mutation in an array
of mutations to be issued. Set after the validity of the
mutation has been confirmed.
Example :
Returns : string
Args : integer
prelabel
Title : prelabel
Usage : $obj->prelabel();
Function:
Sets and returns the prelabel of the affected original allele
location. Prelabel is a stable identifier whereas location
can be changed by mutations. Prelabel comes from
l<Bio::LiveSeq::Gene>.
Example :
Returns : string
Args : string
postlabel
Title : postlabel
Usage : $obj->postlabel();
Function:
Sets and returns the postlabel of the affected original allele
location. Postlabel is a stable identifier whereas location
can be changed by mutations. Postlabel comes from
l<Bio::LiveSeq::Gene>.
Example :
Returns : string
Args : string
lastlabel
Title : lastlabel
Usage : $obj->lastlabel();
Function:
Sets and returns the lastlabel of the affected original allele
location. Lastlabel is a stable identifier whereas location
can be changed by mutations. Lastlabel comes from
l<Bio::LiveSeq::Gene>.
Example :
Returns : string
Args : string
perl v5.14.2 2012-03-02 Bio::LiveSeq::Mutation(3pm)