BP_GCCALC(1p) User Contributed Perl Documentation BP_GCCALC(1p)NAME
gccalc - GC content of nucleotide sequences
SYNOPSIS
gccalc [-f/--format FORMAT] [-h/--help] filename
or
gccalc [-f/--format FORMAT] < filename
or
gccalc [-f/--format FORMAT] -i filename
DESCRIPTION
This scripts prints out the GC content for every nucleotide sequence from the input file.
OPTIONS
The default sequence format is fasta.
The sequence input can be provided using any of the three methods:
unnamed argument
gccalc filename
named argument
gccalc -i filename
standard input
gccalc < filename
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the
Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the
web:
https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Jason Stajich
Email jason@bioperl.org
HISTORY
Based on script code (see bottom) submitted by cckim@stanford.edu
Submitted as part of bioperl script project 2001/08/06
perl v5.14.2 2012-03-02 BP_GCCALC(1p)
Check Out this Related Man Page
BP_OLIGO_COUNT(1p) User Contributed Perl Documentation BP_OLIGO_COUNT(1p)NAME
oligo_count - oligo count and frequency
SYNOPSIS
Usage: oligo_count [-h/--help] [-l/--length OLIGOLENGTH]
[-f/--format SEQFORMAT] [-i/--in/-s/--sequence SEQFILE]
[-o/--out OUTFILE]
DESCRIPTION
This scripts counts occurrence and frequency for all oligonucleotides of given length.
It can be used to determine what primers are useful for frequent priming of nucleic acid for random labeling.
Note that this script could be run by utilizing the compseq program which is part of EMBOSS.
OPTIONS
The default sequence format is fasta. If no outfile is given, the results will be printed to standard out. All other options can entered
interactively.
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the
Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the
web:
https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Charles C. Kim
Email cckim@stanford.edu
HISTORY
Written July 2, 2001
Submitted to bioperl scripts project 2001/08/06
>> 100 x speed optimization by Heikki Lehvaslaiho
perl v5.14.2 2012-03-02 BP_OLIGO_COUNT(1p)
Dear Experts,
Please help to teach me how to add the filename into the file content so that i can get the output below:-
Actually the file name
***************New output that I want***************
=====2005-11-12=====
EVENTS-20050912 03:33:37 ALARM: BTSSPAN-277-1 30-18013... (2 Replies)
Hi,
Any help on this would be very appreciated.
I capture the full path & filename in a variable like (varFile=/home/user/extfile.txt). Now in my shell script I have to use only the filename part i.e. extfile.txt. How do I extract only the filename part from the variable?
Thanks in... (3 Replies)
Greetings,
I am trying to write script, (preferably in sh) that will use a proprietary program to print the resolution and name of files in the current working directory in a vertical format.
I think this script will require 3 commands with variables and a pipe to the prop program, but am not... (6 Replies)
I like to have the date in the 2008-09-01 format at the beginning of my filenames. I then hyphenate after that and then have my filename.
I have a script that creates this for me. However, I may be working on files that already have the date format already in there and so I don't want to have a... (4 Replies)
For example, if I have the file whose content are:
>HWI-EAS382_30FC7AAXX:7:1:927:1368
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>HWI-EAS382_30FC7AAXX:7:1:924:1373
ACGAACTTTAAAGCACCTCTTGGCTCGTATGCCGTC
I want my output calculate the total of nucleotide. So my output should look like this:... (2 Replies)
Hi,
I am trying to execute a perl script from c program.
I tried using system command.
system("perl test.pl filename") ;
This perl program takes filename as input and prints a number
to screen.
I need to get that returned number in C program.
system command is... (3 Replies)
How to delete a particular character in a file and then removing the spaces created by that removal.I am working with a text file containing nucleotide sequences.
I have tried sed command but it replaces N with spaces.
example:I want to delete all the N without creating a space after its ... (1 Reply)
KINDLY HELP ME FOR SHELL SCRIPTING FOR THIS TASK.
My input file consists of thousands of sequence in this format. The given input file consists of four sequences which are starting with ‘>’ symbol (each sequence shown in different colour for easy understanding). I have to use a command at $... (3 Replies)
Hi.. I have a seperate chromosome sequences and i wanted to parse some regions of chromosome based on start site and end site.. how can i achieve this?
For Example Chr 1 is in following format
I need regions from 2 - 10 should give me AATTCCAAA
and in a similar way 15- 25 should give... (8 Replies)
Hello,
A bioperl problem I thought could be done with awk: convert the fasta format (Note: the length of each row is not the same for each entry as they were combined from different files!) to tabular format.
input.fasta:
>YAL069W-1.334 Putative promoter sequence... (6 Replies)
Hello friends . I am newbie to perl scripting but still managed to write a code but i am stuck at a place where i need help . Below is the code and can someone help me in taking user input for changing the font size for a html table .Thank you in advance
#!/bin/ksh
echo " Enter the Directory... (4 Replies)
Hello,
I am trying to create a file in windows and i want the filename to have timestamp as well but something is wrong and i can not understand waht. The code that i use is the following
($cwkday,$cmonth,$cday,$ctime,$cyear) = split(/\s+/, localtime);
$current_date =... (5 Replies)
Hello,
Is possibly there a way to prepend the filename to its content without a third file? The reason is to add a header to each file contents to distinguish each other when they are pasted side-by-side.
sample.txt:
XLOC_001 0
XLOC_002 23
XLOC_003 4
XLOC_012 6output (with the same... (4 Replies)
Hi,
I have a file which has wrong time format and we want to correct it before we load it.
WRONG FORMAT : 93:0:00
CORRECT FORMAT :09:30:00
If you notice the 0 at the front is missing. Its the case always. (6 Replies)