BP_SEARCH2TRIBE(1p) User Contributed Perl Documentation BP_SEARCH2TRIBE(1p)NAME
search2tribe - Turn SearchIO parseable reports(s) into TRIBE matrix
SYNOPSIS
Usage:
search2tribe [-o outputfile] [-f reportformat] [-w/--weight] file1 file2 ..
DESCRIPTION
This script is probably too slow for most people's uses. It is better to use something like scripts/searchio/fastam9_to_table, -m 9 output
from BLAST, or the blast2table from the BLAST O'Reilly book to get a tabular output from these programs and then feed the table into MCL
with the mcxdeblast script and the --m9 option.
This script will turn a protein Search report (BLASTP, FASTP, SSEARCH) into a Markov Matrix for TribeMCL clustering.
The options are:
-o filename - the output filename [default STDOUT]
-f format - search result format (blast, fasta)
(ssearch is fasta format). default is blast.
-w or --weight VALUE - Change the default weight for E(0.0) hits
to VALUE (default=200 (i.e. 1e-200) )
-h - this help menu
Additionally specify the filenames you want to process on the command-line. If no files are specified then STDIN input is assumed. You
specify this by doing: search2tribe < file1 file2 file3
AUTHOR
Jason Stajich, jason-at-bioperl-dot-org
perl v5.14.2 2012-03-02 BP_SEARCH2TRIBE(1p)
Check Out this Related Man Page
BP_MASK_BY_SEARCH(1p) User Contributed Perl Documentation BP_MASK_BY_SEARCH(1p)NAME
mask_by_search - mask sequence(s) based on its alignment results
SYNOPSIS
mask_by_search.pl -f blast genomefile blastfile.bls > maskedgenome.fa
DESCRIPTION
Mask sequence based on significant alignments of another sequence. You need to provide the report file and the entire sequence data which
you want to mask. By default this will assume you have done a TBLASTN (or TFASTY) and try and mask the hit sequence assuming you've
provided the sequence file for the hit database. If you would like to do the reverse and mask the query sequence specify the -t/--type
query flag.
This is going to read in the whole sequence file into memory so for large genomes this may fall over. I'm using DB_File to prevent keeping
everything in memory, one solution is to split the genome into pieces (BEFORE you run the DB search though, you want to use the exact file
you BLASTed with as input to this program).
Below the double dash (--) options are of the form --format=fasta or --format fasta or you can just say -f fasta
By -f/--format I mean either are acceptable options. The =s or =n or =c specify these arguments expect a 'string'
Options:
-f/--format=s Search report format (fasta,blast,axt,hmmer,etc)
-sf/--sformat=s Sequence format (fasta,genbank,embl,swissprot)
--hardmask (booelean) Hard mask the sequence
with the maskchar [default is lowercase mask]
--maskchar=c Character to mask with [default is N], change
to 'X' for protein sequences
-e/--evalue=n Evalue cutoff for HSPs and Hits, only
mask sequence if alignment has specified evalue
or better
-o/--out/
--outfile=file Output file to save the masked sequence to.
-t/--type=s Alignment seq type you want to mask, the
'hit' or the 'query' sequence. [default is 'hit']
--minlen=n Minimum length of an HSP for it to be used
in masking [default 0]
-h/--help See this help information
AUTHOR - Jason Stajich
Jason Stajich, jason-at-bioperl-dot-org.
perl v5.14.2 2012-03-02 BP_MASK_BY_SEARCH(1p)
Hi
i need to have a update for a file that updates only the last modified content from another file....
say for example....if file A is having content like
.
.
.
hatxxxx
catxxxx
ratxxxx
and file B(the file to be updated is having content as
hatxxxx
catxxxx
then file B has to be... (12 Replies)
Hi,
Can someone help me with a perl file to rename some files please? I can do it with regular command line using the below code, but I need to include this in another script and the other script is perl. I know nothing of perl.
for file in C*
do
newfilename=`echo $file | cut -c8-21-`... (8 Replies)
Hi all,
I'm having a problem with a script which should ultimately provide a filename by reading a value from file1 and file2 then join together.
I'm planning to use a loop/ loops to get the values out of both files and create a single string unfortunately the code currently treats the second... (7 Replies)
Hey everyone,
I would really appreciate some help with a problem I have filing away some data I have. I have multiple fasta files that have different pieces of information in each. I want to split each file into parts, and then file away each separate part into its own file. Here is an example... (8 Replies)
Hi All,
I have script to handle nulls in column2 from file1.txt and redirect its output to file2.txt
I am confused with run-time command line arguments. b'cause i normal unix we use $1 $2 for two parameters. But in awk it treat $1 as column1.
So, i tried with awk -v var1 -v var2... how to... (7 Replies)
Hi,
I have to write one script that has to search a list of numbers in certain zipped files.
For eg. one file file1.txt contains the numbers. File1.txt contains 5,00,000 numbers and I have to search each number in zipped files(The number of zipped files are around 1000 each file is 5 MB)
I have... (10 Replies)
Hi.. I have a seperate chromosome sequences and i wanted to parse some regions of chromosome based on start site and end site.. how can i achieve this?
For Example Chr 1 is in following format
I need regions from 2 - 10 should give me AATTCCAAA
and in a similar way 15- 25 should give... (8 Replies)
Hello every body ! I'm a new in this forum and beginner in Perl scripting and I have some problems :(:(:(! I have a big file like that :
ID1 ID2 Identity
chromosome07_194379 chromosome01_168057 0.975
chromosome01_100293 chromosome01_168057 ... (23 Replies)
Hi All,
I have result log file which looks like this (below): from the content need to consolidate the result and put it in tabular form
1). Intercomponents Checking
Passed: All Server are passed.
======================================================================
2). OS version Checking... (9 Replies)
Hi -- Working on my own through the book "Learning the KornShell and came to task 4-1, which there is:
a script "highest" and it will sort an "album" file.
highest filename
The author mentions adding a header line to the scripts output if the user types in the -h option. It says "assume the... (9 Replies)
Hello,
Currently i have a script which will disply the results in plain text format.
I want to format the result in more readable format like Making bold headings and format with colors etc. Something like html and send that content as email.
Please help me how i can do that.
I am using... (10 Replies)
Dears Please support
I have out put in text file and look like below
fixed inquiries - Click on MAX suffix http://server:port/app
User Details http://server:port/app
Audit User Detail Action hhttp://server:port/app
fixed inquiries - Click on MAX suffix http://server:port/app
User Details ... (13 Replies)
Dear linux users
I was running around of 200 djob for a Blastp search in a cluster. All my input files were protein fasta file (prot.fna.1, prot.fna.2 ...prot.fna.200). The output of each individual slurm job is located in a corresponding file ending with *test (prot.fna.1.test,... (10 Replies)
I have two fasta files as shown below,
File:1
>Contig_1:90600-91187
AAGGCCATCAAGGACGTGGATGAGGTCGTCAAGGGCAAGGAACAGGAATTGATGACGGTC
>Contig_98:35323-35886
GACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCCTGGATCTGGTCGAAATCCAGCCGCAG
>Contig_24:26615-28387... (11 Replies)