bio::tools::analysis::simpleanalysisbase(3pm) [debian man page]
Bio::Tools::Analysis::SimpleAnalysisBase(3pm) User Contributed Perl Documentation Bio::Tools::Analysis::SimpleAnalysisBase(3pm) NAME
Bio::Tools::Analysis::SimpleAnalysisBase - abstract superclass for SimpleAnalysis implementations SYNOPSIS
# not to be run directly DESCRIPTION
This class is a generic implementation of SimpleAnalysisI and should be used as a base class for specific implementations. Modules implementing SimpleAnalysisBase only need to provide specific _init(), _run() and result() methods, plus any get/set methods for parameters to the analysis program. SEE ALSO
Bio::SimpleAnalysisI, Bio::WebAgent FEEDBACK
Mailing Lists User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists Support Please direct usage questions or support issues to the mailing list: bioperl-l@bioperl.org rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: https://redmine.open-bio.org/projects/bioperl/ AUTHORS
Richard Adams, Richard.Adams@ed.ac.uk, Heikki Lehvaslaiho, heikki-at-bioperl-dot-org APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ new Usage : $job->new(...) Returns : a new analysis object, Args : none (but an implementation may choose to add arguments representing parameters for the analysis program. Each key value of must have a method implemented for it in a subclass. A seq () method is provided here as this will probably be needed by all sequence analysis programs seq Usage : $job->seq() Returns : a Bio::PrimarySeqI implementing sequence object, or void Args : None, or a Bio::PrimarySeqI implementing object analysis_name Usage : $analysis->analysis_name(); Returns : The analysis name Arguments : none analysis_spec Usage : $analysis->analysis_spec(); Returns : a hash reference to a hash of analysis parameters. See Bio::SimpleAnalysisI for a list of recommended key values. Arguments: none clear Usage : $analysis->clear(); Returns : true value on success Arguments : none Purpose : to remove raw results from a previous analysis so that an analysis can be repeated with different parameters. input_spec Usage : $analysis->input_spec(); Returns : a reference to an array of hashes of analysis parameters. See Bio::SimpleAnalysisI for a list of recommended key values. Arguments : none result_spec Usage : $analysis->result_spec(); Returns : a reference to a hashes of resultformats. See Bio::SimpleAnalysisI for a list of recommended key values. The key values can be used as parameters to the result() method, the values provide descriptions. Arguments : none perl v5.14.2 2012-03-02 Bio::Tools::Analysis::SimpleAnalysisBase(3pm)
Check Out this Related Man Page
Bio::Tools::Analysis::DNA::ESEfinder(3pm) User Contributed Perl Documentation Bio::Tools::Analysis::DNA::ESEfinder(3pm) NAME
Bio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder server SYNOPSIS
use Bio::Tools::Analysis::DNA::ESEfinder; use strict; my $seq; # a Bio::PrimarySeqI or Bio::SeqI object $seq = Bio::Seq->new( -primary_id => 'test', -seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'. -alphabet=>'dna'); my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder-> new(-seq => $seq); # run ESEfinder prediction on a DNA sequence $ese_finder->run(); die "Could not get a result" unless $ese_finder->status =~ /^COMPLETED/; print $ese_finder->result; # print raw prediction to STDOUT foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) { # do something to SeqFeature # e.g. print as GFF print $feat->gff_string, " "; # or store within the sequence - if it is a Bio::SeqI $seq->add_SeqFeature($feat) } DESCRIPTION
This class is a wrapper around the ESEfinder web server which uses experimentally defined scoring matrices to identify possible exonic splicing enhancers in human transcripts. The results can be retrieved in 4 ways. 1. "$ese_finder->result('')" retrieves the raw text output of the program 2. "$ese_finder->result('all')" returns a Bio::Seq::Meta::Array object with prediction scores for all residues in the sequence 3. "$ese_finder->result('Bio::SeqFeatureI')" returns an array of Bio::SeqFeature objects for sequences with significant scores. Feature tags are score, motif, SR_protein and method 4. "$ese_finder->result('raw')" returns an array of significant matches with each element being a reference to [SR_protein, position, motif, score] See <http://rulai.cshl.edu/tools/ESE2/> This the second implentation of Bio::SimpleAnalysisI which hopefully will make it easier to write wrappers on various services. This class uses a web resource and therefore inherits from Bio::WebAgent. SEE ALSO
Bio::SimpleAnalysisI, Bio::WebAgent FEEDBACK
Mailing Lists User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists Support Please direct usage questions or support issues to the mailing list: bioperl-l@bioperl.org rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: https://redmine.open-bio.org/projects/bioperl/ AUTHORS
Richard Adams, Richard.Adams@ed.ac.uk, Heikki Lehvaslaiho, heikki-at-bioperl-dot-org APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ perl v5.14.2 2012-03-02 Bio::Tools::Analysis::DNA::ESEfinder(3pm)