10 More Discussions You Might Find Interesting
1. Shell Programming and Scripting
HI ,
I m looking for help here!!!
Can we filter the below log data into CSV format ?
timestamp INFO <text > - Some text Drive ..
Need a format of separate field such as
1 2 3 4 ... (2 Replies)
Discussion started by: MohSalNiz
2 Replies
2. Shell Programming and Scripting
Hello Gentlemen,
Finding difficulties to play with my Input files:confused: . Your guidance will certainly help as always.
After converting to csv file from XLSM file, I am getting some extra ""(double quote) characters which I want to terminate inside shell script and process it further.
... (6 Replies)
Discussion started by: pradyumnajpn10
6 Replies
3. UNIX for Dummies Questions & Answers
Hi,
I'm trying to combine two files which have 1 column in common and filter out rows I don't need.
File 1:
ID Start End Matched Coverage
1 1 254 1515 5.96
2 1 135 402 2.98
File 2 (has 2 rows per entry):
>1... (4 Replies)
Discussion started by: Yarinka
4 Replies
4. Shell Programming and Scripting
Hi All,
I have a output like below
$ cat aa.lst
Value of output parameters
---------------------------------------
Parameter Name : SNAPSHOTTIMESTAMP
Parameter Value : 2014-01-07-15.21.50.022423
Parameter Name : DATABASESIZE
Parameter Value : 96178176
... (2 Replies)
Discussion started by: kamauv234
2 Replies
5. UNIX for Dummies Questions & Answers
Thanks everyone. I got that problem solved.
I require one more help here. (Yes, UNIX definitely seems to be fun and useful, and I WILL eventually learn it for myself. But I am now on a different project and don't really have time to go through all the basics. So, I will really appreciate some... (6 Replies)
Discussion started by: latsyrc
6 Replies
6. Shell Programming and Scripting
Hi Guys,
i want copy the all files another direcotry after filtering the command.
and tried as like below...it's not working.
ls -ltr|awk '{print $9}'|grep "images\|\.htm"|cp *.* /home/oracle
Thanks (13 Replies)
Discussion started by: bmk
13 Replies
7. Shell Programming and Scripting
"Help Me" Need script for transferring bulk files from one format to text format in a unix server.
Please suggest (2 Replies)
Discussion started by: Kranthi Kumar
2 Replies
8. UNIX for Dummies Questions & Answers
Hello,
I have two files in this form that consist of three columns, a name (L*contig*), the length (length=**) and the sequence
LT_file.txt
LTcontig1 length=13 acccatgctttta
LTcontig5 length=8 ggattacc
LTcontig8 length=20 ccattgaccgtacctgatcg
LTcontig23 length=5 accta
and... (5 Replies)
Discussion started by: FelipeAd
5 Replies
9. Shell Programming and Scripting
Hi,
I need to filter and store the files ends with log extension in the array and need to write the file names in the array to a file.
I need to use array to derive this solution. Please help me out.
Thanks (2 Replies)
Discussion started by: Sekar1
2 Replies
10. Shell Programming and Scripting
Hi,
I have a very big directory structure that consists of many sub-directories inside.There are around 50 ".gz" files under this dir structure.
I want to copy all the gz files alone to a seperate location.
Plz help me. (2 Replies)
Discussion started by: villain41
2 Replies